Internal ID | 17702066 | Source Database | TransTermHP TERM 2 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 2
|
Sequence |
TCCGATGCTCGTTTCCGGGCATCGGA Look for more occurrences |
Start | 9422 |
End | 9447 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas monteilii NBRC 103158 = DSM 14164 Q381DRAFT_scaffold00008.8_C, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCGGGACGCAAAAAA(5' tail) TCCGATGCTCG(5' stem) TTTC(loop) CGGGCATCGGA(3' stem) TTTTTGCATTCCGGG(3' tail). Confidence: 100. opp_overlap 9422 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|