| Internal ID | 17691240 | Source Database | TransTermHP TERM 143 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 143
|
| Sequence |
CGACCCGCTTGTGGCGGGTCG Look for more occurrences |
| Start | 534105 |
| End | 534125 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. URHB0015 N526DRAFT_scaffold00005.5_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCCCCCCTCCCAAA(5' tail) CGACCCGCC(5' stem) ACA(loop) AGCGGGTCG(3' stem) TTTGCCATCTACCCC(3' tail). Confidence: 95. opp_overlap 534105 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|