| Internal ID | 17690577 | Source Database | TransTermHP TERM 44 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 44
|
| Sequence |
GAAAGCCCCGGCAACGGGGCTTTC Look for more occurrences |
| Start | 256769 |
| End | 256792 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas umsongensis UNC430CL58Col N519DRAFT_scaffold00001.1, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGTGAACCGTGGAAA(5' tail) GAAAGCCCCG(5' stem) TTGC(loop) CGGGGCTTTC(3' stem) ATTTCGATCGCGATT(3' tail). Confidence: 100. opp_overlap 256768 256769 256773, overlap 256773 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|