| Internal ID | 17690403 | Source Database | TransTermHP TERM 5 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 5
|
| Sequence |
GGCGCCCGCGTAAAACCGGTCGCC Look for more occurrences |
| Start | 32577 |
| End | 32600 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas umsongensis UNC430CL58Col N519DRAFT_scaffold00012.12_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAATCAAACCAGAAA(5' tail) GGCGCCCGCGT(5' stem) AAA(loop) AC-CGGTCGCC(3' stem) TTTTTTGCTGACTCC(3' tail). Confidence: 100. gap 1, opp_overlap 32577 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|