Internal ID | 17690372 | Source Database | TransTermHP TERM 37 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 37
|
Sequence |
GGCCAACGCTAAGCGTTGGCC Look for more occurrences |
Start | 108243 |
End | 108263 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas umsongensis UNC430CL58Col N519DRAFT_scaffold00011.11_C, whole genome shotgun sequence. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | ACGCGCAATAAAAAA(5' tail) GGCCAACGC(5' stem) TTA(loop) GCGTTGGCC(3' stem) TTTTTTGTTTTAGCG(3' tail). Confidence: 100. opp_overlap 108243 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|