| Internal ID | 17690030 | Source Database | TransTermHP TERM 27 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 27
|
| Sequence |
GCCGCACGACCTTCGGGTCGTGCGGC Look for more occurrences |
| Start | 59181 |
| End | 59206 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas umsongensis UNC430CL58Col N519DRAFT_scaffold00006.6_C, whole genome shotgun sequence. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATTCAACTACAAAAA(5' tail) GCCGCACGACC(5' stem) TTCG(loop) GGTCGTGCGGC(3' stem) TTTTTTGCGTTCGGC(3' tail). Confidence: 100. opp_overlap 59181 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|