Internal ID | 17688913 | Source Database | TransTermHP TERM 645 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 645
|
Sequence |
GCCCGCTCATTTGAGCGGGC Look for more occurrences |
Start | 2070374 |
End | 2070393 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas denitrificans ATCC 13867, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | ACCGGAGCCATTCCA(5' tail) GCCCGCTC(5' stem) ATTT(loop) GAGCGGGC(3' stem) TTTTTTATGGGCTGA(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|