| Internal ID | 17687881 | Source Database | TransTermHP TERM 413 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 413
|
| Sequence |
CGCCCGGGCGAGATTCGCTCGGGCG Look for more occurrences |
| Start | 1883856 |
| End | 1883880 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas poae RE*1-1-14, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCGCCCTCAAAAAA(5' tail) CGCCCGGGCGA(5' stem) GAT(loop) TCGCTCGGGCG(3' stem) TTTTTTTATACCCAG(3' tail). Confidence: 100. opp_overlap 1883856 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|