Internal ID | 17687851 | Source Database | TransTermHP TERM 365 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 365
|
Sequence |
CAGGCGCCGAAAGGCGCCTG Look for more occurrences |
Start | 1604356 |
End | 1604375 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas poae RE*1-1-14, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GAGGATTGAATAAAA(5' tail) CAGGCGCC(5' stem) GAAA(loop) GGCGCCTG(3' stem) TTTTCGTTCCTGCGG(3' tail). Confidence: 100. opp_overlap 1604351 1604356 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|