| Internal ID | 17687851 | Source Database | TransTermHP TERM 365 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 365
|
| Sequence |
CAGGCGCCGAAAGGCGCCTG Look for more occurrences |
| Start | 1604356 |
| End | 1604375 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas poae RE*1-1-14, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GAGGATTGAATAAAA(5' tail) CAGGCGCC(5' stem) GAAA(loop) GGCGCCTG(3' stem) TTTTCGTTCCTGCGG(3' tail). Confidence: 100. opp_overlap 1604351 1604356 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|