| Internal ID | 17687569 | Source Database | TransTermHP TERM 1613 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1613
|
| Sequence |
AGCCCGGCTCCGGCCGGGCA Look for more occurrences |
| Start | 6631263 |
| End | 6631282 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas protegens CHA0, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CATCAGGCAAAAAAA(5' tail) TGCCCGGC(5' stem) CGGA(loop) GCCGGGCT(3' stem) TTTTTTCTTGCGCGA(3' tail). Confidence: 100. opp_overlap 6631264, overlap 6631264 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|