| Internal ID | 17687020 | Source Database | TransTermHP TERM 777 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 777
|
| Sequence |
CGGCCTGGCTCTGTCCAGGCCG Look for more occurrences |
| Start | 3206753 |
| End | 3206774 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas protegens CHA0, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TTTTACAATTATTCA(5' tail) CGGCCTGG(5' stem) CTCTGT(loop) CCAGGCCG(3' stem) TTTTTATTTGTGCTT(3' tail). Confidence: 100. opp_overlap 3206749 3206747 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|