Internal ID | 17686441 | Source Database | TransTermHP TERM 1387 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1387
|
Sequence |
GGGCGATCCACATGGATCGCCC Look for more occurrences |
Start | 5984891 |
End | 5984912 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas sp. UW4 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AGCCGATACAAAAAA(5' tail) GGGCGATCC(5' stem) ACAT(loop) GGATCGCCC(3' stem) TTTTTTCACCCGCTT(3' tail). Confidence: 100. opp_overlap 5984891 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|