Internal ID | 17685244 | Source Database | TransTermHP TERM 746 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 746
|
Sequence |
CAGAGCCGGCATGCCGGCTCTG Look for more occurrences |
Start | 3521236 |
End | 3521257 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas stutzeri RCH2 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCAATAGCGTTGAAA(5' tail) CAGAGCCGG(5' stem) CATG(loop) CCGGCTCTG(3' stem) CGGATCACCCCACCC(3' tail). Confidence: 90. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|