| Internal ID | 17683204 | Source Database | TransTermHP TERM 691 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 691
|
| Sequence |
GAACGCCCCGCATTGCGGGGCGTTC Look for more occurrences |
| Start | 2861070 |
| End | 2861094 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa B136-33, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGTAGCCGAGAAGCA(5' tail) GAACGCCCCGC(5' stem) ATT(loop) GCGGGGCGTTC(3' stem) TTTTTCGCAGCCGGG(3' tail). Confidence: 100. opp_overlap 2861070 2861073 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|