| Internal ID | 17682758 | Source Database | TransTermHP TERM 1514 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1514
|
| Sequence |
CGCCCGGCCTTGGCCGGGCG Look for more occurrences |
| Start | 6734958 |
| End | 6734977 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida H8234, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GACCGCAAACGAAAA(5' tail) CGCCCGGC(5' stem) CAAG(loop) GCCGGGCG(3' stem) TCGAAGCTCGGGAGC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|