| Internal ID | 17682477 | Source Database | TransTermHP TERM 1070 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1070
|
| Sequence |
GGCTGGCAGCGAAAACTGCCGGCC Look for more occurrences |
| Start | 5145889 |
| End | 5145912 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida H8234, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CACATACAGCAAAAA(5' tail) GGCCGGCAG(5' stem) TTTTCG(loop) CTGCCAGCC(3' stem) TTCTTGATTACTTGG(3' tail). Confidence: 100. opp_overlap 5145883 5145889, overlap 5145882 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|