| Internal ID | 17681376 | Source Database | TransTermHP TERM 896 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 896
|
| Sequence |
GGGCCGGGAACTCCCGGCCC Look for more occurrences |
| Start | 3569392 |
| End | 3569411 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas putida HB3267, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCTGTTCGCTCGTC(5' tail) GGGCCGGG(5' stem) AACT(loop) CCCGGCCC(3' stem) TTTGCTGTGGTATAT(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|