| Internal ID | 17681375 | Source Database | TransTermHP TERM 895 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 895
|
| Sequence |
GCGCCCTGCCTTGTGCAGGGCGC Look for more occurrences |
| Start | 3568728 |
| End | 3568750 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas putida HB3267, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGGCCTCTAATTCCA(5' tail) GCGCCCTGC(5' stem) CTTGT(loop) GCAGGGCGC(3' stem) TTTCATTTGCGCAAT(3' tail). Confidence: 100. overlap 3568711 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|