| Internal ID | 17678622 | Source Database | TransTermHP TERM 627 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 627
|
| Sequence |
GGCGGGCTCTAGAGCCCGCC Look for more occurrences |
| Start | 2808703 |
| End | 2808722 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri DSM 4166 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCAGGGAATAAAAAA(5' tail) GGCGGGCT(5' stem) CTAG(loop) AGCCCGCC(3' stem) TTTCGTTTTGCCTAC(3' tail). Confidence: 100. opp_overlap 2808703 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|