| Internal ID | 17677532 | Source Database | TransTermHP TERM 1536 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1536
|
| Sequence |
GGCTCACCTCCGGGTGGGCC Look for more occurrences |
| Start | 5898429 |
| End | 5898448 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa DK2 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGAATACGACGAAAA(5' tail) GGCTCACC(5' stem) TCCG(loop) GGTGGGCC(3' stem) TTTTTGCTTTCCGCC(3' tail). Confidence: 100. opp_overlap 5898429 5898423, overlap 5898423 5898422 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|