| Internal ID | 17677241 | Source Database | TransTermHP TERM 1087 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1087
|
| Sequence |
CGTTGCCGCCAACAATGGCGGCAACG Look for more occurrences |
| Start | 4481581 |
| End | 4481606 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa DK2 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCCGGAAGGAGGAA(5' tail) CGTTGCCGCCA(5' stem) TTGT(loop) TGGCGGCAACG(3' stem) CCGTCATACACGGGA(3' tail). Confidence: 95. opp_overlap 4481574 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|