| Internal ID | 17675326 | Source Database | TransTermHP TERM 738 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 738
|
| Sequence |
GCCGACCCACAAGTGGGTCGGC Look for more occurrences |
| Start | 3762446 |
| End | 3762467 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida BIRD-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACGGATTGTTAAGAA(5' tail) GCCGACCCA(5' stem) CTTG(loop) TGGGTCGGC(3' stem) TTTTTTATTGCCTTT(3' tail). Confidence: 91. opp_overlap 3762446 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|