| Internal ID | 17672863 | Source Database | TransTermHP TERM 1398 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1398
|
| Sequence |
CGGCGCAGCCTCCCCCGCTGCGCCG Look for more occurrences |
| Start | 6651135 |
| End | 6651159 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens F113 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATCGAGTAATAAGGT(5' tail) CGGCGCAGC(5' stem) CTCCCCC(loop) GCTGCGCCG(3' stem) TTTTCGTCTTGAAAG(3' tail). Confidence: 100. opp_overlap 6651133 6651132 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|