| Internal ID | 17672173 | Source Database | TransTermHP TERM 450 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 450
|
| Sequence |
CGCCGGGCTGAAGAGCCCGGCG Look for more occurrences |
| Start | 1962795 |
| End | 1962816 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens F113 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GATTCCCAAAAAAAA(5' tail) CGCCGGGCT(5' stem) GAAG(loop) AGCCCGGCG(3' stem) TTTTTTTATGCGTTG(3' tail). Confidence: 100. opp_overlap 1962795, overlap 1962784 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|