| Internal ID | 17671600 | Source Database | TransTermHP TERM 1067 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1067
|
| Sequence |
CGCCGCGACGAATCGCGGCG Look for more occurrences |
| Start | 4018222 |
| End | 4018241 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas mendocina NK-01 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGCGCAAACAAAAA(5' tail) CGCCGCGA(5' stem) CGAA(loop) TCGCGGCG(3' stem) TTTTTGTTTGTGTGT(3' tail). Confidence: 100. opp_overlap 4018222, overlap 4018212 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|