| Internal ID | 17670371 | Source Database | TransTermHP TERM 733 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 733
|
| Sequence |
CAAAGGCCCCGAAATCGGGGCCTTTG Look for more occurrences |
| Start | 2414690 |
| End | 2414715 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fulva 12-X chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TATCCGCCGCAATGA(5' tail) CAAAGGCCCCG(5' stem) ATTT(loop) CGGGGCCTTTG(3' stem) TTTATCTGCAGGTTT(3' tail). Confidence: 100. opp_overlap 2414690 2414694, overlap 2414694 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|