| Internal ID | 17669922 | Source Database | TransTermHP TERM 40 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 40
|
| Sequence |
CGCGGCGCCCCTCTCCGGGGCGCCCG Look for more occurrences |
| Start | 171037 |
| End | 171062 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fulva 12-X chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GAGCGCCAATAGAAA(5' tail) CG-GGCGCCCC(5' stem) GGAGA(loop) GGGGCGCCGCG(3' stem) GTGCTTACGCCACGT(3' tail). Confidence: 95. gap 1, opp_overlap 171036 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|