| Internal ID | 17669021 | Source Database | TransTermHP TERM 259 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 259
|
| Sequence |
CGCCCCGAACCAGTCGGGGCG Look for more occurrences |
| Start | 1012122 |
| End | 1012142 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas brassicacearum subsp. brassicacearum NFM421 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCTGAACAAGCAAA(5' tail) CGCCCCGA(5' stem) CTGGT(loop) TCGGGGCG(3' stem) TTTTGCTGTGTGGTG(3' tail). Confidence: 100. opp_overlap 1012117 1012122, overlap 1012117 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|