| Internal ID | 17668454 | Source Database | TransTermHP TERM 910 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 910
|
| Sequence |
CGCCCGGGCGACCTCGCCTGGGCG Look for more occurrences |
| Start | 3938158 |
| End | 3938181 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida GB-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACTCGGATACAAAAA(5' tail) CGCCCAGGCG(5' stem) AGGT(loop) CGCCCGGGCG(3' stem) TTTGACGGGGCGGTA(3' tail). Confidence: 100. opp_overlap 3938158 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|