| Internal ID | 17667129 | Source Database | TransTermHP TERM 2017 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 2017
|
| Sequence |
CCGCCTCCACGTCGAGTGGAGGCGG Look for more occurrences |
| Start | 6344345 |
| End | 6344369 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens Pf0-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGCGTTGAAAAAAAA(5' tail) CCGCCTCCAC(5' stem) TCGAC(loop) GTGGAGGCGG(3' stem) TTTCGATAAAGACGT(3' tail). Confidence: 100. opp_overlap 6344345 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|