Internal ID | 17666714 | Source Database | TransTermHP TERM 1512 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1512
|
Sequence |
GCCGCATGACTTTTGGGTTGTGCGGC Look for more occurrences |
Start | 4871378 |
End | 4871403 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas fluorescens Pf0-1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GGTTGATAAAACAAA(5' tail) GCCGCATGACT(5' stem) TTTG(loop) GGTTGTGCGGC(3' stem) TTTTTTGTGTCTGGT(3' tail). Confidence: 100. opp_overlap 4871378, overlap 4871367 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|