| Internal ID | 17666633 | Source Database | TransTermHP TERM 1405 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1405
|
| Sequence |
CCCGCCGAGGCTTGCGCCGTGGCGGG Look for more occurrences |
| Start | 4537286 |
| End | 4537311 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens Pf0-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGGGCAATAAAAAA(5' tail) CCCGCCACGGC(5' stem) GCAA(loop) GCCTCGGCGGG(3' stem) TTTTGTCTTCCAGCT(3' tail). Confidence: 100. opp_overlap 4537286 4537281 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|