| Internal ID | 17666034 | Source Database | TransTermHP TERM 626 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 626
|
| Sequence |
CAAAGGCCACCTTCGGGTGGCCTTTG Look for more occurrences |
| Start | 1810957 |
| End | 1810982 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens Pf0-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCTCTGCTCCAGCAA(5' tail) CAAAGGCCACC(5' stem) TTCG(loop) GGTGGCCTTTG(3' stem) TCGTTTCCGGCGTTC(3' tail). Confidence: 95. opp_overlap 1810957 1810961, overlap 1810954 1810961 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|