| Internal ID | 17665961 | Source Database | TransTermHP TERM 530 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 530
|
| Sequence |
GGTCAGAGCCTCTCGGCTCTGGCC Look for more occurrences |
| Start | 1538402 |
| End | 1538425 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens Pf0-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGAAAATTTTTTATA(5' tail) GGTCAGAGCC(5' stem) TCTC(loop) GGCTCTGGCC(3' stem) TTGTTTGTTGTTCCC(3' tail). Confidence: 100. overlap 1538398 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|