| Internal ID | 17665150 | Source Database | TransTermHP TERM 308 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 308
|
| Sequence |
GAAAAAGCCCCTTTCGGGGCTTTTTC Look for more occurrences |
| Start | 1313764 |
| End | 1313789 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri A1501 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGAGCAGCAGGCAT(5' tail) GAAAAAGCCCC(5' stem) TTTC(loop) GGGGCTTTTTC(3' stem) TTTTTACAGATCGAA(3' tail). Confidence: 100. opp_overlap 1313770, overlap 1313770 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|