| Internal ID | 17665088 | Source Database | TransTermHP TERM 204 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 204
|
| Sequence |
GCCGGGCCTCGGAAGAGCCCGGC Look for more occurrences |
| Start | 908050 |
| End | 908072 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri A1501 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCGTAGAGCGCAGAA(5' tail) GCCGGGCCTC(5' stem) GGAA(loop) GAG-CCCGGC(3' stem) TTTTTTGCGGCTGGT(3' tail). Confidence: 100. gap 1, opp_overlap 908050 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|