| Internal ID | 17662548 | Source Database | TransTermHP TERM 375 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 375
|
| Sequence |
CAAGCCCCGCAACTGGCGGGGCTTCG Look for more occurrences |
| Start | 1671948 |
| End | 1671973 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PA7 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AACTGGCAGAAAAAA(5' tail) CGAAGCCCCGC(5' stem) CAGTT(loop) GCGGGGCTT-G(3' stem) CTTGCGTGCCGGCGG(3' tail). Confidence: 100. gap 1, opp_overlap 1671952, overlap 1671952 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|