Internal ID | 17661752 | Source Database | TransTermHP TERM 801 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 801
|
Sequence |
CGGCCTGGCTCTGTCCAGGCCG Look for more occurrences |
Start | 3188585 |
End | 3188606 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas protegens Pf-5 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | TTTTACAATTATTCA(5' tail) CGGCCTGG(5' stem) CTCTGT(loop) CCAGGCCG(3' stem) TTTTTATTTGTGCTT(3' tail). Confidence: 100. opp_overlap 3188581 3188579 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|