| Internal ID | 17661096 | Source Database | TransTermHP TERM 1213 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1213
|
| Sequence |
GGGAGACCGGAGCGGTCTCCC Look for more occurrences |
| Start | 5279659 |
| End | 5279679 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. phaseolicola 1448A chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CAAAGTTTACAGACA(5' tail) GGGAGACCG(5' stem) CTC(loop) CGGTCTCCC(3' stem) TGACCCGCGTCATGC(3' tail). Confidence: 100. overlap 5279657 5279648 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|