| Internal ID | 17659875 | Source Database | TransTermHP TERM 793 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 793
|
| Sequence |
CCTCGAACCGCGCTCGGTTCGGGG Look for more occurrences |
| Start | 3487419 |
| End | 3487442 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. syringae B728a chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCAAAAGCTGAAAAA(5' tail) CCCCGAACCG(5' stem) AGCG(loop) CGGTTCGAGG(3' stem) TTTTTCGGGCATCGG(3' tail). Confidence: 100. opp_overlap 3487419 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|