| Internal ID | 17659128 | Source Database | TransTermHP TERM 1116 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1116
|
| Sequence |
CCCTGATGCTCGCGCGTCAGGG Look for more occurrences |
| Start | 4921128 |
| End | 4921149 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas syringae pv. tomato str. DC3000 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTGCAACGAAAAAAA(5' tail) CCCTGACGC(5' stem) GCGA(loop) GCATCAGGG(3' stem) TTTTTTTCTGTCCGC(3' tail). Confidence: 100. opp_overlap 4921115 4921128 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|