| Internal ID | 17656821 |
| Source Database | TransTermHP TERM 388 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 388
|
| Sequence |
CAAGCCCCGCAATTGGCGGGGCTTCG Look for more occurrences |
| Start | 1627528 |
| End | 1627553 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa UCBPP-PA14 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGGCCGCCGGAAAAA(5' tail) CGAAGCCCCGC(5' stem) CAATT(loop) GCGGGGCTT-G(3' stem) CTTGCGGTGTGGACG(3' tail). Confidence: 95. gap 1, opp_overlap 1627532, overlap 1627532 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|