Internal ID | 17656560 |
Source Database | TransTermHP TERM 1494 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1494
|
Sequence |
GGCCCGGCGTTTCGCCGGGCC Look for more occurrences |
Start | 6053238 |
End | 6053258 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | ATCAGGTGCGTACTT(5' tail) GGCCCGGCG(5' stem) TTT(loop) CGCCGGGCC(3' stem) TTTCTTTTCTGCCAC(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|