| Internal ID | 17656556 | Source Database | TransTermHP TERM 1489 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1489
|
| Sequence |
CCCCTGGTCAGCGATGACCGGGGG Look for more occurrences |
| Start | 6039550 |
| End | 6039573 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCGCAAAAGCAAAA(5' tail) CCCCCGGTCA(5' stem) TCGC(loop) TGACCAGGGG(3' stem) TTTTGGGATAGGAGC(3' tail). Confidence: 100. opp_overlap 6039550, overlap 6039545 6039544 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|