| Internal ID | 17656485 | Source Database | TransTermHP TERM 1376 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1376
|
| Sequence |
GAAACCCCGCCTTGGCGGGGTTTC Look for more occurrences |
| Start | 5683424 |
| End | 5683447 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGGCGCAGGCAAAAA(5' tail) GAAACCCCGC(5' stem) CAAG(loop) GCGGGGTTTC(3' stem) TTTTTATCCGGCGGA(3' tail). Confidence: 100. opp_overlap 5683424 5683428, overlap 5683428 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|