| Internal ID | 17656476 | Source Database | TransTermHP TERM 1359 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1359
|
| Sequence |
CGCCCGCCGCATCCGGCGGGCG Look for more occurrences |
| Start | 5593640 |
| End | 5593661 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGGCGAAAACGAAAA(5' tail) CGCCCGCCG(5' stem) GATG(loop) CGGCGGGCG(3' stem) TCGGGTCCTGCGAAT(3' tail). Confidence: 100. overlap 5593623 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|