Internal ID | 17656296 |
Source Database | TransTermHP TERM 1112 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1112
|
Sequence |
GCCCGCCACGCTTGTCGTGGCGGGC Look for more occurrences |
Start | 4884678 |
End | 4884702 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGCCAGCCAGGAAGA(5' tail) GCCCGCCACG(5' stem) CTTGT(loop) CGTGGCGGGC(3' stem) TCTGTGCTTTGCCCG(3' tail). Confidence: 91. opp_overlap 4884676, overlap 4884676 4884672 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|