Internal ID | 17655974 |
Source Database | TransTermHP TERM 577 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 577
|
Sequence |
AAGCCCGCCTTCAGGCGGGCTC Look for more occurrences |
Start | 2657756 |
End | 2657777 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CTGTACAGAAACAAA(5' tail) GAGCCCGCC(5' stem) TGAA(loop) GGCGGGCTT(3' stem) TGAACGGAACGGACC(3' tail). Confidence: 95. opp_overlap 2657758, overlap 2657758 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|