Internal ID | 17655971 | Source Database | TransTermHP TERM 574 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 574
|
Sequence |
GAACGCCCCGCAATGCGGGGCGTTC Look for more occurrences |
Start | 2657651 |
End | 2657675 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCCGACTGCGAAAAA(5' tail) GAACGCCCCGC(5' stem) AAT(loop) GCGGGGCGTTC(3' stem) TGCTTCTCGGCTACC(3' tail). Confidence: 100. opp_overlap 2657651, overlap 2657654 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|