| Internal ID | 17655909 | Source Database | TransTermHP TERM 473 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 473
|
| Sequence |
GAGGGAGCCAGGGCTCCCTC Look for more occurrences |
| Start | 1986949 |
| End | 1986968 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas aeruginosa PAO1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATCCTGAAATGAAAA(5' tail) GAGGGAGC(5' stem) CCTG(loop) GCTCCCTC(3' stem) TTCGCGCGTTCGCCG(3' tail). Confidence: 100. opp_overlap 1986951 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|